Cell In Silico


Molecules - Sequence - Disease

Menu

Debug Diary: Running MaxEntScan

September 24, 2021 | 5 Minute Read

MaxEntScan

  • is an algorithm to score splice site strength

Installation

I was able to install it with conda

conda create -n maxentscan
conda activate maxentscan
conda install -c bioconda maxentscan

The reason to use conda is that the Perl dependency is not easy to handle if I install by myself. Since someone has already solved it, why not use it?

But there is no documentation in how to run the program

  • The only thing I can find is this, the server in Burge Lab’s website. http://hollywood.mit.edu/burgelab/maxent/Xmaxentscan_scoreseq.html
  • Then I found link Download perl wrappers

Running the command in READTHIS does not work

LINK TO READTHIS

perl score5.pl test5 
perl score3.pl test3

returns “can’t open perl script “score3”: No such file or directory”

I figured that the script is not added to the path, and to do this I need to find where conda puts the script.

Locating the script

Thus, in the maxentscan env, I typed:

which perl

as I know the perl is installed along with maxentscan. And knowing where perl is can help me find where the script is located.

Apparently perl is located in ~/miniconda3/envs/maxentscan/bin/perl.

Therefore the script is likely in ~/miniconda3/envs/maxentscan/bin/

I went there cd ~/miniconda3/envs/maxentscan/bin/ and was able to locate the 2 scripts, but named differently. (WHY!!!!!)

they are named maxentscan_score3.pl and maxentscan_score5.pl

Running the script

Usually those scripts will have a help message when you call them with nothing.

But it doesn’t.

maxentscan_score5.pl
maxentscan_score3.pl -h 
maxentscan_score3.pl --help 

will only show “can’t open”, which is confusing.

Assuming that this is the same script as the one on the Burge lab website, I download the test data:

wget http://hollywood.mit.edu/burgelab/maxent/download/fordownload/test3
wget http://hollywood.mit.edu/burgelab/maxent/download/fordownload/test5

and test it

maxentscan_score3.pl test3

returns: “ctctactactatctatctagatc 6.71”

It worked.

TLDR How do I run MaxEntScan if I install via conda?

conda create -n maxentscan
conda activate maxentscan
conda install -c bioconda maxentscan
wget http://hollywood.mit.edu/burgelab/maxent/download/fordownload/test3
wget http://hollywood.mit.edu/burgelab/maxent/download/fordownload/test5
maxentscan_score3.pl test3

It turns out that there is already a python wrapper of it.

Running it transcriptome wide

maxentscan takes a fasta file which contains the 5’ss or 3’ss sequence of designated length.

Referencing to NovaSplice’s way to generate exon_junction.bed I wrote the following script:

First I find all the exons

from pybedtools import BedTool
coord=BedTool('/home/hsher/gencode_coords/gencode.v33.annotation.gff3')

# generate intron by subtracting exon from intron
exons=coord.filter(lambda x: x[2]=='exon').saveas()

Then for every exon, a 3’ss is at the 5’ end of the exon. 5’ss is at the 3’ end of an exon. I save those intervals along with its name to a list.

all_5ss=[]
all_3ss=[]
for exon in exons:
    
    
    if exon.strand == '+':
        ss3_start = exon.start-20
        ss3_end = exon.start+3
        ss3_site = exon.start
        
        ss5_start=exon.end-3
        ss5_end=exon.end+6
        ss5_site = exon.end
    if exon.strand == '-':
        ss5_start = exon.start-6
        ss5_end = exon.start+3
        ss5_site = exon.start
        
        ss3_start = exon.end-3
        ss3_end = exon.end+20
        
        ss3_site = exon.end
    
    all_5ss.append([exon.chrom, ss5_start, ss5_end, exon.strand, exon.attrs['transcript_id'], exon.attrs['gene_id'], ss5_site])
    all_3ss.append([exon.chrom, ss3_start, ss3_end, exon.strand, exon.attrs['transcript_id'], exon.attrs['gene_id'], ss3_site])

Convert the list to bedtools and use BedTool getfastq to fetch the sequence.

import pandas as pd
df5=pd.DataFrame(all_5ss, columns = ['chrom', 'start', 'end', 'strand', 'transcript_id', 'gene_id'])
b=BedTool.from_dataframe(df5[['chrom', 'start', 'end',  'transcript_id', 'gene_id', 'strand']])
x = b.sequence(fi='/home/hsher/gencode_coords/GRCh38.p13.genome.fa', s = True,
               fo='/home/hsher/gencode_coords/gencode.v33.5ss.fasta')

df3=pd.DataFrame(all_3ss, columns = ['chrom', 'start', 'end', 'strand', 'transcript_id', 'gene_id'])
b=BedTool.from_dataframe(df3[['chrom', 'start', 'end',  'transcript_id', 'gene_id', 'strand']])
x = b.sequence(fi='/home/hsher/gencode_coords/GRCh38.p13.genome.fa', s = True,
              fo='/home/hsher/gencode_coords/gencode.v33.3ss.fasta')

Looking at the output:

(maxentscan) [hsher@tscc-login2 ~]$ head /home/hsher/gencode_coords/gencode.v33.5ss.fasta
>chr1:12224-12233(+)
CCAGTAAGT
>chr1:12718-12727(+)
GAGGTGAGA
>chr1:14406-14415(+)
CTGCTCAGT
>chr1:12054-12063(+)
GAGCACTGG
>chr1:12224-12233(+)

This file can now be fed into score5.pl:

maxentscan_score5.pl /home/hsher/gencode_coords/gencode.v33.5ss.fasta

However, I am not a big fan of the output format, because we lost the genomic coordinate, and will make downstream analysis hard:

CCAGTAAGT       9.09
GAGGTGAGA       7.66
CTGCTCAGT       -1.67
GAGCACTGG       -13.87
CCAGTAAGT       9.09
CTTGTGAGT       7.15
TAGGCAAGC       1.14
GAAGTTCAC       -12.10
GAAGAAATG       -7.27
GTGAGCGTG       -27.71

Also, sequences with ‘N’ will crash the program :)

# this crashes maxentscan
>chr4:9272911-9272920(+)
AGATCNNNN

So I filtered sequences with N, and did a bit of wrangling

# find unique 5ss sequences without N
unique_5ss=df5.loc[~df5['seq'].str.contains('N'),'seq'].unique()

# write to file
import os
with open('/home/hsher/gencode_coords/unique_5ss.txt', 'w') as f:
    for seq in unique_5ss:
        f.write(seq+'\n')

Then feed to maxentscan

maxentscan_score5.pl /home/hsher/gencode_coords/unique_5ss.txt > /home/hsher/gencode_coords/unique_5ss.maxentscore

read the file back to python pandas dataframe and map to the original dataframe with genome coordinates

score5 = pd.read_csv('/home/hsher/gencode_coords/unique_5ss.maxentscore', sep = '\t', index_col = 0, names= ['score'])
df5['maxentscore']=df5['seq'].map(score5['score'])

Final output

  chrom start end strand transcript_id gene_id seq maxentscore
0 chr1 12224 12233 + ENST00000456328.2 ENSG00000223972.5 CCAGTAAGT 9.09
1 chr1 12718 12727 + ENST00000456328.2 ENSG00000223972.5 GAGGTGAGA 7.66
2 chr1 14406 14415 + ENST00000456328.2 ENSG00000223972.5 CTGCTCAGT -1.67
3 chr1 12054 12063 + ENST00000450305.2 ENSG00000223972.5 GAGCACTGG -13.87
4 chr1 12224 12233 + ENST00000450305.2 ENSG00000223972.5 CCAGTAAGT 9.09